From 7e1d3988b4009efde1385597462b1a799676c0d8 Mon Sep 17 00:00:00 2001 From: Nils Homer Date: Fri, 19 Jun 2026 00:19:32 -0700 Subject: [PATCH 1/4] feat(build): honor BED12 blocks in --keep-bed (position-precise keep-set) parse_bed now treats a 12+-column line as BED12: keep only its blocks (blockCount/blockSizes/blockStarts, cols 10/11/12), not the whole [start,end) span. A <12-column line stays BED3 (whole interval), so existing keep/mask BEDs are unchanged. This lets the keep-set encode position-precise homology (e.g. length-1 / short contiguous-run k-mer start positions) compactly, one BED line per region, which the tiered (Design Z) .sa filter consumes unchanged via keep_doubled_pos. Block fields are validated (integer, count match, non-zero length, checked arithmetic against overflow, within chromEnd) with line-numbered errors. Adds unit tests for BED12 block parsing, trailing-comma tolerance, mixed BED3/BED12 files, length-1 blocks, coordinate-overflow rejection, and the other malformed-input rejections. --- prmi/src/train/mask.rs | 237 ++++++++++++++++++++++++++++++++++++++++- 1 file changed, 232 insertions(+), 5 deletions(-) diff --git a/prmi/src/train/mask.rs b/prmi/src/train/mask.rs index 2c35050..6f524cb 100644 --- a/prmi/src/train/mask.rs +++ b/prmi/src/train/mask.rs @@ -53,7 +53,7 @@ pub struct BedInterval { pub end: u64, } -/// Parse a BED file into a sorted list of `BedInterval`s. +/// Parse a BED file into a sorted, merged list of `BedInterval`s. /// /// Comment lines (`#`), track/browser header lines, and blank lines are /// silently skipped. Requires at least 3 whitespace-separated columns @@ -61,10 +61,22 @@ pub struct BedInterval { /// intervals are concatenated genome-wide, matching the flat-genome /// coordinate space used by the trainer. /// -/// Returns an error if any data line has fewer than 3 columns, or if -/// start/end are not valid integers, or if `end <= start`. +/// Per-line BED3 vs BED12 (decided by column count): +/// - **BED3** (3–11 columns): keep the whole `[start, end)` interval. This is +/// the canonical target / coarse-homology shape and is unchanged. +/// - **BED12** (≥12 columns): keep ONLY the blocks. Columns 10/11/12 are +/// `blockCount` / comma-separated `blockSizes` / comma-separated +/// `blockStarts` (offsets relative to `start`); block `i` contributes +/// `[start + blockStarts[i], start + blockStarts[i] + blockSizes[i])`. This +/// lets the keep-set encode position-precise homology (e.g. length-1 / short +/// contiguous-run k-mer start positions) compactly, one BED line per region. /// -/// The returned vector is sorted by `start`. +/// Returns an error if any data line has fewer than 3 columns, if start/end or +/// any block field is not a valid integer, if `end <= start`, or if a BED12 +/// line's blocks are malformed (count mismatch, zero-length, or extending past +/// `end`). +/// +/// The returned vector is sorted by `start` and overlapping intervals merged. pub fn parse_bed(path: &Path) -> Result> { let text = std::fs::read_to_string(path).map_err(|source| Error::Io { path: path.to_path_buf(), @@ -114,7 +126,13 @@ pub fn parse_bed(path: &Path) -> Result> { ), }); } - out.push(BedInterval { start, end }); + // A 12+-column line carries BED12 block fields (cols 10/11/12): keep + // only the blocks. Anything narrower is BED3: keep the whole interval. + if cols.len() >= 12 { + push_bed12_blocks(&mut out, &cols, start, end, lineno)?; + } else { + out.push(BedInterval { start, end }); + } } out.sort_by_key(|i| i.start); @@ -141,6 +159,105 @@ pub fn parse_bed(path: &Path) -> Result> { Ok(out) } +/// Parse the BED12 block fields of a single line and append one `BedInterval` +/// per block to `out`. +/// +/// `cols` is the whitespace-split line (already known to have ≥12 columns); +/// `start`/`end` are the line's chromStart/chromEnd. Per the BED12 spec, column +/// 10 (`cols[9]`) is `blockCount`, column 11 (`cols[10]`) is comma-separated +/// `blockSizes`, and column 12 (`cols[11]`) is comma-separated `blockStarts` +/// (offsets relative to `start`). A trailing comma (UCSC-style) is tolerated. +/// Block `i` contributes `[start + starts[i], start + starts[i] + sizes[i])`. +/// +/// Errors (all `InvalidInput`, with the 1-based line number) on a non-integer +/// field, `blockCount == 0`, a size/start-count mismatch, a zero-length block, +/// or a block extending past `end`. +fn push_bed12_blocks( + out: &mut Vec, + cols: &[&str], + start: u64, + end: u64, + lineno: usize, +) -> Result<()> { + let err = |detail: String| Error::InvalidInput { detail }; + let block_count: usize = cols[9].parse().map_err(|_| { + err(format!( + "BED parse error at line {}: bad blockCount {:?}", + lineno + 1, + cols[9] + )) + })?; + if block_count == 0 { + return Err(err(format!( + "BED parse error at line {}: blockCount is 0 (a BED12 line must have >=1 block)", + lineno + 1 + ))); + } + // Split a comma-separated u64 list, tolerating a single trailing comma. + let split_u64 = |field: &str, what: &str| -> Result> { + field + .split(',') + .filter(|s| !s.is_empty()) + .map(|s| { + s.parse::().map_err(|_| { + err(format!( + "BED parse error at line {}: bad {} entry {:?}", + lineno + 1, + what, + s + )) + }) + }) + .collect() + }; + let sizes = split_u64(cols[10], "blockSizes")?; + let starts = split_u64(cols[11], "blockStarts")?; + if sizes.len() != block_count || starts.len() != block_count { + return Err(err(format!( + "BED parse error at line {}: blockCount {} but got {} blockSizes and {} blockStarts", + lineno + 1, + block_count, + sizes.len(), + starts.len() + ))); + } + for i in 0..block_count { + if sizes[i] == 0 { + return Err(err(format!( + "BED parse error at line {}: block {} has zero length", + lineno + 1, + i + ))); + } + // Checked arithmetic: a malformed line with huge blockStart/blockSize + // could otherwise wrap and slip past the `be > end` bound check below. + let bs = start.checked_add(starts[i]); + let be = bs.and_then(|bs| bs.checked_add(sizes[i])); + let (bs, be) = match (bs, be) { + (Some(bs), Some(be)) => (bs, be), + _ => { + return Err(err(format!( + "BED parse error at line {}: block {} coordinates overflow", + lineno + 1, + i + ))) + } + }; + if be > end { + return Err(err(format!( + "BED parse error at line {}: block {} [{}, {}) extends past chromEnd {}", + lineno + 1, + i, + bs, + be, + end + ))); + } + out.push(BedInterval { start: bs, end: be }); + } + Ok(()) +} + /// Decide whether a doubled-text suffix-array position should be RETAINED by a /// tiered keep-mask (Design Z). /// @@ -387,6 +504,116 @@ mod tests { ); } + // --- BED12 block parsing ------------------------------------------------- + + #[test] + fn parse_bed12_keeps_only_blocks_not_whole_span() { + // Line spans [100, 200) but declares 2 blocks: [100,110) and [150,170). + // BED12 keeps ONLY the blocks; the [110,150) and [170,200) gaps are out. + let mut f = NamedTempFile::new().unwrap(); + writeln!(f, "chr1\t100\t200\tr\t0\t+\t100\t200\t0\t2\t10,20\t0,50").unwrap(); + let intervals = parse_bed(f.path()).unwrap(); + assert_eq!(intervals.len(), 2, "two disjoint blocks, not the whole span"); + assert_eq!((intervals[0].start, intervals[0].end), (100, 110)); + assert_eq!((intervals[1].start, intervals[1].end), (150, 170)); + assert!(covered_by_bed(&intervals, 100)); + assert!(covered_by_bed(&intervals, 109)); + assert!(!covered_by_bed(&intervals, 110), "block1 end is exclusive"); + assert!(!covered_by_bed(&intervals, 120), "inter-block gap not kept"); + assert!(covered_by_bed(&intervals, 150)); + assert!(covered_by_bed(&intervals, 169)); + assert!(!covered_by_bed(&intervals, 170), "block2 end is exclusive"); + assert!(!covered_by_bed(&intervals, 199), "span tail past last block not kept"); + } + + #[test] + fn parse_bed12_tolerates_trailing_comma() { + // UCSC writes blockSizes/blockStarts with a trailing comma. + let mut f = NamedTempFile::new().unwrap(); + writeln!(f, "chr1\t100\t200\tr\t0\t+\t100\t200\t0\t2\t10,20,\t0,50,").unwrap(); + let intervals = parse_bed(f.path()).unwrap(); + assert_eq!(intervals.len(), 2); + assert_eq!((intervals[0].start, intervals[0].end), (100, 110)); + assert_eq!((intervals[1].start, intervals[1].end), (150, 170)); + } + + #[test] + fn parse_bed12_length1_blocks_are_position_precise() { + // The k-mer-homology generator's shape: single-position blocks marking + // exact suffix-start positions. Two length-1 blocks at offsets 0 and 5. + let mut f = NamedTempFile::new().unwrap(); + writeln!(f, "chr1\t1000\t1010\tr\t0\t+\t1000\t1010\t0\t2\t1,1\t0,5").unwrap(); + let intervals = parse_bed(f.path()).unwrap(); + assert_eq!(intervals.len(), 2); + assert_eq!((intervals[0].start, intervals[0].end), (1000, 1001)); + assert_eq!((intervals[1].start, intervals[1].end), (1005, 1006)); + assert!(covered_by_bed(&intervals, 1000)); + assert!(!covered_by_bed(&intervals, 1001)); + assert!(covered_by_bed(&intervals, 1005)); + assert!(!covered_by_bed(&intervals, 1004)); + } + + #[test] + fn parse_bed_mixed_bed3_and_bed12_lines() { + // BED3 line kept whole; BED12 line kept by blocks; both coexist + merge. + let mut f = NamedTempFile::new().unwrap(); + writeln!(f, "chr1\t0\t50").unwrap(); + writeln!(f, "chr1\t100\t200\tr\t0\t+\t100\t200\t0\t1\t10\t0").unwrap(); + let intervals = parse_bed(f.path()).unwrap(); + assert_eq!(intervals.len(), 2); + assert_eq!((intervals[0].start, intervals[0].end), (0, 50)); + assert_eq!((intervals[1].start, intervals[1].end), (100, 110)); + } + + #[test] + fn parse_bed12_rejects_block_count_mismatch() { + let mut f = NamedTempFile::new().unwrap(); + // blockCount=2 but only one size/start each. + writeln!(f, "chr1\t100\t200\tr\t0\t+\t100\t200\t0\t2\t10\t0").unwrap(); + let err = parse_bed(f.path()).unwrap_err(); + assert!(format!("{err}").contains("blockCount")); + } + + #[test] + fn parse_bed12_rejects_block_past_chrom_end() { + let mut f = NamedTempFile::new().unwrap(); + // Block [100, 260) extends past chromEnd 200. + writeln!(f, "chr1\t100\t200\tr\t0\t+\t100\t200\t0\t1\t160\t0").unwrap(); + let err = parse_bed(f.path()).unwrap_err(); + assert!(format!("{err}").contains("extends past chromEnd")); + } + + #[test] + fn parse_bed12_rejects_zero_block_count() { + let mut f = NamedTempFile::new().unwrap(); + // 12 columns so the BED12 branch is taken, but blockCount is 0. + writeln!(f, "chr1\t100\t200\tr\t0\t+\t100\t200\t0\t0\t1\t0").unwrap(); + let err = parse_bed(f.path()).unwrap_err(); + assert!(format!("{err}").contains("blockCount is 0")); + } + + #[test] + fn parse_bed12_rejects_overflowing_block_coords() { + let mut f = NamedTempFile::new().unwrap(); + // blockStart near u64::MAX would wrap start+blockStart; must be rejected + // rather than slipping past the chromEnd bound via wraparound. + writeln!( + f, + "chr1\t100\t200\tr\t0\t+\t100\t200\t0\t1\t10\t18446744073709551610" + ) + .unwrap(); + let err = parse_bed(f.path()).unwrap_err(); + assert!(format!("{err}").contains("overflow")); + } + + #[test] + fn parse_bed12_rejects_zero_length_block() { + let mut f = NamedTempFile::new().unwrap(); + writeln!(f, "chr1\t100\t200\tr\t0\t+\t100\t200\t0\t1\t0\t0").unwrap(); + let err = parse_bed(f.path()).unwrap_err(); + assert!(format!("{err}").contains("zero length")); + } + // --- covered_by_bed ------------------------------------------------------ #[test] From e88365e2b401a7b9c5244970e35a338a7e7ec707 Mon Sep 17 00:00:00 2001 From: Nils Homer Date: Fri, 19 Jun 2026 00:19:45 -0700 Subject: [PATCH 2/4] feat(keepset): k-mer homology keep-set construction (`prmi keepset`) Add `prmi keepset --ref --targets [-k] [--max-occ] [--flank] [--bed12]`: build a flat-coordinate Design-Z keep-set from a reference and a per-contig target BED. The keep-set is the union of (a) the target intervals kept whole and (b) the START positions of every reference k-mer that is a forward or reverse-complement copy of a target k-mer whose reference count is <= max-occ (high-copy repeats are dropped; they fall back regardless). Only the suffix-start of each homolog is kept, matching the tiered .sa's keyed-at-start filter -- keeping the whole [p, p+k) span would over-keep on merge. Memory is bounded by the target k-mer count, not the genome: only target k-mers are tracked, and counting is skipped entirely when uncapped (counting every genome k-mer would need ~140 GB on hg38). A shared for_each_kmer helper drives the three rolling-window passes. Output is in prmi's flat concatenated-genome coordinate space (the space `prmi build` and parse_bed operate in); the tool owns the per-contig -> flat mapping so real per-contig target BEDs work directly. Emits one BED3 line per maximal kept run, or compact BED12 (--bed12) packing runs as blocks; both decode to the identical keep-set. k and --blocks-per-line are validated before the reference is read so an invalid knob fails fast. Productionizes the build_halo_bed measurement prototype with correct start-only emission, reverse-complement homology, multi-contig support, and BED3/BED12 output. The pure core (compute_keep_runs) is unit-tested on synthetic sequences; an end-to-end build (keepset -> build --keep-bed) yields a byte-identical tiered .sa from both the BED3 and BED12 forms. --- prmi/src/cli.rs | 117 +++++++ prmi/src/keepset.rs | 751 ++++++++++++++++++++++++++++++++++++++++++++ prmi/src/lib.rs | 1 + 3 files changed, 869 insertions(+) create mode 100644 prmi/src/keepset.rs diff --git a/prmi/src/cli.rs b/prmi/src/cli.rs index f396d01..7acecca 100644 --- a/prmi/src/cli.rs +++ b/prmi/src/cli.rs @@ -174,6 +174,43 @@ pub enum Cmd { #[arg(long, default_value_t = 1)] threads: usize, }, + /// Build a Design-Z keep-set BED from a reference + per-contig target BED. + /// + /// Emits a FLAT-coordinate keep-set (targets kept whole + the start + /// positions of forward/reverse-complement k-mer homologs of target k-mers + /// under the count cap) suitable for `prmi build --keep-bed`. The output is + /// in prmi's concatenated-genome coordinate space, NOT per-contig. + Keepset { + /// Reference FASTA (same contig order `prmi build` will use). + #[arg(long, value_name = "PATH")] + r#ref: PathBuf, + /// Per-contig BED3 of target regions (chrom must match FASTA names). + #[arg(long, value_name = "PATH")] + targets: PathBuf, + /// Output keep-set BED path (`-` for stdout). + #[arg(short = 'o', long, value_name = "PATH", default_value = "-")] + out: PathBuf, + /// k-mer length for homology detection (1..=32). Default provisional + /// pending the item-3 benchmark. + #[arg(short = 'k', long, default_value_t = 32)] + k: usize, + /// Drop target k-mers whose total reference count exceeds this cap; + /// `0` = uncapped (keep every homolog). + #[arg(long, default_value_t = 0)] + max_occ: u64, + /// Extend each kept run by this many bp on both sides before merging. + #[arg(long, default_value_t = 0)] + flank: u64, + /// Emit compact BED12 (blocks) instead of one BED3 line per run. + #[arg(long, default_value_t = false)] + bed12: bool, + /// BED12 only: maximum blocks packed per line. + #[arg(long, default_value_t = 1000)] + blocks_per_line: usize, + /// Cosmetic chrom label for the flat-coordinate output BED. + #[arg(long, default_value = "genome")] + chrom_label: String, + }, } /// Subcommands for `prmi shm`. @@ -366,6 +403,86 @@ impl Cli { println!("OK: {n} SA entries certified against the lexicographic oracle"); Ok(()) } + Cmd::Keepset { + r#ref, + targets, + out, + k, + max_occ, + flank, + bed12, + blocks_per_line, + chrom_label, + } => { + // Validate up front (before reading the reference, which may be + // whole-genome) so an invalid knob fails fast with a clear error. + // These are user-input violations, so preserve the crate's + // `InvalidInput` categorization (matching the --with-isa guard + // above) rather than a generic anyhow error. + if !(1..=32).contains(&k) { + return Err(crate::Error::InvalidInput { + detail: format!("--k must be in 1..=32, got {k}"), + } + .into()); + } + if blocks_per_line < 1 { + return Err(crate::Error::InvalidInput { + detail: format!("--blocks-per-line must be >= 1, got {blocks_per_line}"), + } + .into()); + } + let opts = crate::keepset::KeepsetOptions { + k, + max_occ, + flank, + format: if bed12 { + crate::keepset::KeepsetFormat::Bed12 + } else { + crate::keepset::KeepsetFormat::Bed3 + }, + blocks_per_line, + chrom_label, + }; + // Stream to stdout for "-", else to the named file. + let ctx = || { + format!( + "building keep-set from {} + {}", + r#ref.display(), + targets.display() + ) + }; + // Flush the BufWriter explicitly in each branch: `drop` swallows + // flush errors, so a disk-full / broken-pipe on the final flush + // would otherwise print success and return Ok. + let stats = if out == std::path::Path::new("-") { + let stdout = std::io::stdout(); + let mut w = std::io::BufWriter::new(stdout.lock()); + let stats = crate::keepset::build_keepset(&r#ref, &targets, &opts, &mut w) + .with_context(ctx)?; + std::io::Write::flush(&mut w).context("flushing keep-set output to stdout")?; + stats + } else { + let f = std::fs::File::create(&out) + .with_context(|| format!("creating {}", out.display()))?; + let mut w = std::io::BufWriter::new(f); + let stats = crate::keepset::build_keepset(&r#ref, &targets, &opts, &mut w) + .with_context(ctx)?; + std::io::Write::flush(&mut w).with_context(|| { + format!("flushing keep-set output to {}", out.display()) + })?; + stats + }; + eprintln!( + "keepset: genome={} bp, {} target intervals -> {} kept runs ({} bp, {:.3}%), {} BED lines", + stats.genome_len, + stats.target_intervals, + stats.kept_runs, + stats.kept_bp, + 100.0 * stats.kept_bp as f64 / stats.genome_len.max(1) as f64, + stats.lines_written, + ); + Ok(()) + } Cmd::Shm { cmd } => match cmd { ShmCmd::Load { sidecar_prefix, diff --git a/prmi/src/keepset.rs b/prmi/src/keepset.rs new file mode 100644 index 0000000..88b3763 --- /dev/null +++ b/prmi/src/keepset.rs @@ -0,0 +1,751 @@ +// Copyright (C) 2026 Fulcrum Genomics LLC +// SPDX-License-Identifier: MIT + +//! Keep-set construction (Design Z, item 2): turn a per-contig target BED plus a +//! reference into a flat-coordinate keep-set BED consumable by +//! `prmi build --keep-bed`. +//! +//! The keep-set is the union of: +//! - **Targets** — every position of each target interval (kept whole). +//! - **k-mer homology** — the START position of every reference k-mer that is a +//! forward or reverse-complement copy of a k-mer occurring at a target +//! position, provided that k-mer's reference count is `<= max_occ` (high-copy +//! repeats are dropped — they fall back to the off-target engine regardless). +//! Only the suffix-START position of each homologous copy is kept, because the +//! tiered `.sa` retains an entry iff its suffix-start coordinate is in the +//! keep-set; keeping the whole `[p, p+k)` span would over-keep on merge. +//! +//! Coordinate space: the output BED is in prmi's FLAT concatenated-genome +//! coordinate space (contigs concatenated in FASTA order, one position per base, +//! N included) — the same space `prmi build` operates in and `parse_bed` +//! consumes. The chrom column is a cosmetic label; positions are flat offsets. +//! +//! Output format: [`KeepsetFormat::Bed3`] emits one line per maximal kept run +//! (precise, but potentially many lines); [`KeepsetFormat::Bed12`] packs runs +//! into block-bearing lines (compact). Both decode to the identical kept +//! position set via `parse_bed`. +//! +//! Limitation: homology is detected with a single fixed `k` over exact matches +//! (forward + reverse-complement). It does not capture gapped/SNP-divergent +//! paralogy; that is by design — the off-target fallback serves those reads. + +use crate::encoding::base_to_2bit; +use crate::error::{Error, Result}; +use noodles_fasta::io::Reader; +use std::collections::{HashMap, HashSet}; +use std::io::{BufReader, Write}; +use std::path::Path; + +/// A non-N base reads as 0..=3; this sentinel marks N / non-IUPAC, which resets +/// the rolling k-mer (no k-mer window may span an N). +const N_SENTINEL: u8 = 4; + +/// Output BED flavor for the keep-set. +#[derive(Debug, Clone, Copy, PartialEq, Eq)] +pub enum KeepsetFormat { + /// One BED3 line per maximal kept run. + Bed3, + /// BED12 lines packing up to `blocks_per_line` runs as blocks each. + Bed12, +} + +/// Options controlling keep-set construction. +#[derive(Debug, Clone)] +pub struct KeepsetOptions { + /// k-mer length used to detect homology (1..=32). Default provisional + /// pending the item-3 benchmark. + pub k: usize, + /// Drop target k-mers whose total reference count (forward + reverse + /// complement, counted on the strand-canonical key) exceeds this cap — + /// high-copy repeats, including inverted ones, fall back regardless. `0` + /// means uncapped. + pub max_occ: u64, + /// Extend every kept run by this many bp on each side before merging. `0` + /// keeps the set position-precise. + pub flank: u64, + /// Output BED flavor. + pub format: KeepsetFormat, + /// BED12 only: maximum blocks packed into a single line. + pub blocks_per_line: usize, + /// Cosmetic chrom label written to the (flat-coordinate) output BED. + pub chrom_label: String, +} + +impl Default for KeepsetOptions { + fn default() -> Self { + Self { + k: 32, + max_occ: 0, + flank: 0, + format: KeepsetFormat::Bed3, + blocks_per_line: 1000, + chrom_label: "genome".to_string(), + } + } +} + +/// Summary statistics returned by [`build_keepset`]. +#[derive(Debug, Clone, PartialEq, Eq, Default)] +pub struct KeepsetStats { + /// Flat genome length (sum of contig lengths). + pub genome_len: u64, + /// Number of target intervals mapped to flat coordinates. + pub target_intervals: usize, + /// Number of maximal kept runs emitted (before BED12 packing). + pub kept_runs: usize, + /// Total kept base pairs across all runs. + pub kept_bp: u64, + /// Number of BED lines written. + pub lines_written: usize, +} + +/// One contig's position in the flat concatenated genome. +#[derive(Debug, Clone)] +struct Contig { + name: String, + offset: u64, + len: u64, +} + +/// Read a FASTA into the flat 2-bit genome (ACGT→0..3, N→[`N_SENTINEL`]) and the +/// contig table. Contigs are concatenated in FASTA record order, one position +/// per base, matching `prmi build`'s flat coordinate space (which encodes N→A +/// but still occupies one position, so flat offsets are identical). +fn read_fasta_contigs(path: &Path) -> Result<(Vec, Vec)> { + let file = std::fs::File::open(path).map_err(|source| Error::Io { + path: path.to_path_buf(), + source, + })?; + let mut reader = Reader::new(BufReader::new(file)); + let mut bases: Vec = Vec::new(); + let mut contigs: Vec = Vec::new(); + let mut seen_names: HashSet = HashSet::new(); + for record in reader.records() { + let record = record.map_err(|e| Error::Fasta { + file: path.to_path_buf(), + detail: e.to_string(), + })?; + let name = String::from_utf8_lossy(record.name()).into_owned(); + // `parse_target_bed_to_flat` collapses contigs into a name->offset map; + // a duplicate name would silently overwrite the earlier offset and map + // its targets to the wrong contig, so reject duplicates up front. + if !seen_names.insert(name.clone()) { + return Err(Error::InvalidInput { + detail: format!("reference FASTA contains duplicate contig name {name:?}"), + }); + } + let offset = bases.len() as u64; + let mut len = 0u64; + for &b in record.sequence().as_ref() { + bases.push(base_to_2bit(b).unwrap_or(N_SENTINEL)); + len += 1; + } + contigs.push(Contig { name, offset, len }); + } + Ok((bases, contigs)) +} + +/// Parse a per-contig BED3 target file and map each interval into flat +/// coordinates using the contig table. The chrom column must name a contig in +/// the reference; `end` must not exceed the contig length. +fn parse_target_bed_to_flat( + path: &Path, + contigs: &[Contig], +) -> Result> { + let by_name: HashMap<&str, &Contig> = + contigs.iter().map(|c| (c.name.as_str(), c)).collect(); + let text = std::fs::read_to_string(path).map_err(|source| Error::Io { + path: path.to_path_buf(), + source, + })?; + let mut out: Vec<(u64, u64)> = Vec::new(); + for (lineno, line) in text.lines().enumerate() { + let line = line.trim(); + if line.is_empty() + || line.starts_with('#') + || line.starts_with("track") + || line.starts_with("browser") + { + continue; + } + // Require exact BED3. A wider record (e.g. BED12 with exon blocks) would + // have its block structure silently dropped and be widened to the outer + // [start, end) span — unlike the keep-set OUTPUT, which `parse_bed` + // decodes block-precise. Reject it so the two paths cannot disagree. + let cols: Vec<&str> = line.split_whitespace().collect(); + if cols.len() != 3 { + return Err(Error::InvalidInput { + detail: format!( + "target BED line {}: expected BED3 with exactly 3 columns, got {}", + lineno + 1, + cols.len() + ), + }); + } + let chrom = cols[0]; + let parse = |s: &str, what: &str| -> Result { + s.parse::().map_err(|_| Error::InvalidInput { + detail: format!("target BED line {}: bad {} {:?}", lineno + 1, what, s), + }) + }; + let start = parse(cols[1], "start")?; + let end = parse(cols[2], "end")?; + if end <= start { + return Err(Error::InvalidInput { + detail: format!( + "target BED line {}: end <= start ({} <= {})", + lineno + 1, + end, + start + ), + }); + } + let contig = by_name.get(chrom).ok_or_else(|| Error::InvalidInput { + detail: format!( + "target BED line {}: chrom {:?} not found in reference", + lineno + 1, + chrom + ), + })?; + if end > contig.len { + return Err(Error::InvalidInput { + detail: format!( + "target BED line {}: end {} exceeds contig {:?} length {}", + lineno + 1, + end, + chrom, + contig.len + ), + }); + } + out.push((contig.offset + start, contig.offset + end)); + } + Ok(out) +} + +/// Invoke `f(start, code)` for every full k-mer window in `bases`, where +/// `start` is the window's first position and `code` is its 2-bit packed code. +/// The rolling code resets at any [`N_SENTINEL`] base, so no window spans an N. +/// `k` must be in 1..=32 (caller-validated). +fn for_each_kmer(bases: &[u8], k: usize, mut f: impl FnMut(usize, u64)) { + let mask: u64 = if k == 32 { u64::MAX } else { (1u64 << (2 * k)) - 1 }; + let mut code: u64 = 0; + let mut valid: usize = 0; + for (i, &b) in bases.iter().enumerate() { + if b >= N_SENTINEL { + valid = 0; + code = 0; + continue; + } + code = ((code << 2) | b as u64) & mask; + valid += 1; + if valid >= k { + f(i + 1 - k, code); + } + } +} + +/// Reverse-complement a `for_each_kmer` code: a k-mer packed LOW-aligned into the +/// low `2*k` bits (base 0 in the high `2*(k-1)..2*k` slot). Complements each base +/// (2-bit XOR `0b11`) and reverses base order, returning the RC in the same +/// low-aligned encoding. +/// +/// NOTE: this is *not* [`crate::encoding::reverse_complement_key`], which operates +/// on HIGH-aligned, T-padded 32-mer keys; feeding a low-aligned `for_each_kmer` +/// code to that function mis-aligns the bases for `k < 32` and silently drops RC +/// homologs. Keep the two encodings from crossing. +fn reverse_complement_low(mut code: u64, k: usize) -> u64 { + let mut rc = 0u64; + for _ in 0..k { + rc = (rc << 2) | ((!code) & 0b11); + code >>= 2; + } + rc +} + +/// The strand-canonical key for a low-aligned k-mer code: the lexicographic min +/// of the code and its reverse complement. A k-mer and its RC share one key, so +/// forward/RC homologs compare equal and inverted repeats count toward `max_occ`. +fn canonical_low_key(code: u64, k: usize) -> u64 { + code.min(reverse_complement_low(code, k)) +} + +/// Compute the merged, flat-coordinate kept runs for the keep-set. +/// +/// `bases` is the flat 2-bit genome (values 0..=3, [`N_SENTINEL`] for N). +/// `targets` are flat half-open target intervals (need not be sorted/merged). +/// Returns sorted, merged `[start, end)` runs. +/// +/// Returns [`Error::InvalidInput`] if `k` is outside `1..=32`, or if any target +/// interval is empty/inverted (`end <= start`) or extends past `bases.len()`. +/// +/// Pure (no I/O) so the homology logic can be unit-tested on synthetic input. +pub fn compute_keep_runs( + bases: &[u8], + targets: &[(u64, u64)], + k: usize, + max_occ: u64, + flank: u64, +) -> Result> { + if !(1..=32).contains(&k) { + return Err(Error::InvalidInput { + detail: format!("keep-set k must be in 1..=32, got {k}"), + }); + } + let n = bases.len(); + + // Target-position bitmap (whole intervals are kept). Validate caller input + // rather than silently clipping: an out-of-range or inverted interval is + // malformed (and `s.min(n) > e.min(n)` would panic the slice below), so + // reject it up front. + let mut in_target = vec![false; n]; + for &(s, e) in targets { + if e <= s { + return Err(Error::InvalidInput { + detail: format!("keep-set target end <= start ({e} <= {s})"), + }); + } + if e > n as u64 { + return Err(Error::InvalidInput { + detail: format!("keep-set target end {e} exceeds genome length {n}"), + }); + } + for slot in &mut in_target[s as usize..e as usize] { + *slot = true; + } + } + + // Pass 1: collect the strand-canonical keys of k-mers that START at a target + // position. Canonicalizing here (min of forward and reverse-complement code) + // means a target k-mer and its RC share one key, so inverted homologs match + // and count together later. We deliberately do NOT count all genome k-mers — + // on a whole genome that map would hold billions of entries (~140 GB on + // hg38). Only target k-mers can contribute to the keep-set, so only they are + // tracked. + let mut target_keys: HashSet = HashSet::new(); + for_each_kmer(bases, k, |start, code| { + if in_target[start] { + target_keys.insert(canonical_low_key(code, k)); + } + }); + + // Homology k-mer set: target k-mers under the count cap. When uncapped + // (max_occ == 0) every target k-mer qualifies and no counting is needed; + // otherwise count genome-wide occurrences of TARGET keys ONLY (the map is + // bounded by the number of distinct target k-mers, not the whole genome). + // Counting on the canonical key sums forward and reverse-complement + // occurrences, so inverted high-copy repeats cannot slip under the cap. + let halo: HashSet = if max_occ == 0 { + target_keys + } else { + let mut count: HashMap = HashMap::with_capacity(target_keys.len()); + for_each_kmer(bases, k, |_start, code| { + let key = canonical_low_key(code, k); + if target_keys.contains(&key) { + let c = count.entry(key).or_insert(0); + *c = c.saturating_add(1); + } + }); + target_keys + .into_iter() + .filter(|key| *count.get(key).unwrap_or(&0) <= max_occ) + .collect() + }; + + // Keep bitmap: targets (whole) ∪ homology START positions (length-1). A + // position is a homologous anchor if its k-mer's canonical key matches a + // target k-mer's — which holds for both forward and reverse-complement + // copies (catches inverted paralogs); only the suffix-start position is kept. + let mut keep = in_target; // reuse the target bitmap as the base + for_each_kmer(bases, k, |start, code| { + if halo.contains(&canonical_low_key(code, k)) { + keep[start] = true; + } + }); + + Ok(runs_from_bitmap(&keep, flank)) +} + +/// Extract maximal `true` runs from `keep`, extend each by `flank` on both sides +/// (clamped to `[0, len]`), then sort and merge overlapping runs. +fn runs_from_bitmap(keep: &[bool], flank: u64) -> Vec<(u64, u64)> { + let n = keep.len(); + let mut runs: Vec<(u64, u64)> = Vec::new(); + let mut i = 0usize; + while i < n { + if !keep[i] { + i += 1; + continue; + } + let s = i; + while i < n && keep[i] { + i += 1; + } + let (mut a, mut b) = (s as u64, i as u64); + if flank > 0 { + a = a.saturating_sub(flank); + b = (b + flank).min(n as u64); + } + runs.push((a, b)); + } + if flank == 0 || runs.len() < 2 { + return runs; + } + runs.sort_unstable(); + let mut merged: Vec<(u64, u64)> = Vec::with_capacity(runs.len()); + for (s, e) in runs { + match merged.last_mut() { + Some(last) if s <= last.1 => { + if e > last.1 { + last.1 = e; + } + } + _ => merged.push((s, e)), + } + } + merged +} + +/// Write the kept runs as one BED3 line per run. +fn emit_bed3(out: &mut W, chrom: &str, runs: &[(u64, u64)]) -> Result { + for &(s, e) in runs { + writeln!(out, "{chrom}\t{s}\t{e}").map_err(io_err)?; + } + Ok(runs.len()) +} + +/// Write the kept runs as BED12 lines, packing up to `blocks_per_line` runs as +/// blocks each. Each line's span is `[first_run_start, last_run_end)`; block `i` +/// is `(blockSizes[i], blockStarts[i] = run.start - span_start)`. +fn emit_bed12( + out: &mut W, + chrom: &str, + runs: &[(u64, u64)], + blocks_per_line: usize, +) -> Result { + let mut lines = 0usize; + for chunk in runs.chunks(blocks_per_line.max(1)) { + let span_start = chunk[0].0; + let span_end = chunk[chunk.len() - 1].1; + let sizes: Vec = chunk.iter().map(|&(s, e)| (e - s).to_string()).collect(); + let starts: Vec = + chunk.iter().map(|&(s, _)| (s - span_start).to_string()).collect(); + writeln!( + out, + "{chrom}\t{span_start}\t{span_end}\tkeep\t0\t+\t{span_start}\t{span_end}\t0\t{}\t{}\t{}", + chunk.len(), + sizes.join(","), + starts.join(","), + ) + .map_err(io_err)?; + lines += 1; + } + Ok(lines) +} + +fn io_err(source: std::io::Error) -> Error { + Error::Io { + path: std::path::PathBuf::from(""), + source, + } +} + +/// Build a keep-set BED from a reference FASTA and a per-contig target BED, +/// writing it to `out`. Returns summary statistics. +pub fn build_keepset( + ref_fa: &Path, + target_bed: &Path, + opts: &KeepsetOptions, + out: &mut W, +) -> Result { + let (bases, contigs) = read_fasta_contigs(ref_fa)?; + let genome_len = bases.len() as u64; + let targets = parse_target_bed_to_flat(target_bed, &contigs)?; + let runs = compute_keep_runs(&bases, &targets, opts.k, opts.max_occ, opts.flank)?; + let kept_bp: u64 = runs.iter().map(|&(s, e)| e - s).sum(); + let lines_written = match opts.format { + KeepsetFormat::Bed3 => emit_bed3(out, &opts.chrom_label, &runs)?, + KeepsetFormat::Bed12 => { + emit_bed12(out, &opts.chrom_label, &runs, opts.blocks_per_line)? + } + }; + Ok(KeepsetStats { + genome_len, + target_intervals: targets.len(), + kept_runs: runs.len(), + kept_bp, + lines_written, + }) +} + +#[cfg(test)] +mod tests { + use super::*; + use crate::train::mask::{covered_by_bed, parse_bed}; + use tempfile::NamedTempFile; + + // Build a base vector from an ACGTN string (N -> sentinel). + fn bases(s: &str) -> Vec { + s.bytes() + .map(|b| match b { + b'A' => 0, + b'C' => 1, + b'G' => 2, + b'T' => 3, + _ => N_SENTINEL, + }) + .collect() + } + + fn covered(runs: &[(u64, u64)], p: u64) -> bool { + runs.iter().any(|&(s, e)| p >= s && p < e) + } + + #[test] + fn targets_are_kept_whole() { + // Target [2,5) kept entirely with no homology halo. The target k-mers + // (AACG/ACGG/CGGT at starts 2/3/4) and their reverse complements do not + // recur elsewhere, so the immediate neighbors at 1 (TAAC) and 5 (GGTC) + // stay out. (A periodic sequence like ACGTACGT would make position 1 an + // RC homolog of a target k-mer and thus legitimately kept.) + let b = bases("TTAACGGTCC"); + let runs = compute_keep_runs(&b, &[(2, 5)], 4, 0, 0).unwrap(); + assert!(covered(&runs, 2) && covered(&runs, 4)); + assert!(!covered(&runs, 1) && !covered(&runs, 5)); + } + + #[test] + fn off_target_homolog_start_is_kept() { + // Two exact copies of "ACGTAC" at 0 and 12, separated by a unique GGGGGG + // filler. Target is the single start position 0, so the only target + // k-mer is "ACGTAC"; k=6 -> the copy's START (12) is a forward homolog. + let b = bases("ACGTACGGGGGGACGTACGGGG"); + let runs = compute_keep_runs(&b, &[(0, 1)], 6, 0, 0).unwrap(); + assert!(covered(&runs, 0), "target start kept"); + assert!(covered(&runs, 12), "homolog start at 12 must be kept"); + // Mid-kmer position 13 ("CGTACG") is not a target k-mer start, so the + // start-only keep leaves it out (we do not keep the whole [p,p+k) span). + assert!(!covered(&runs, 13), "only the suffix-start is kept"); + // The GGGGGG filler is neither target nor homolog. + assert!(!covered(&runs, 7), "unique filler not kept"); + } + + #[test] + fn reverse_complement_homolog_is_kept() { + // Target k-mer "AACCGG" (at 0); its reverse complement "CCGGTT" planted + // at 7, isolated from the target by an N so the rolling window cannot + // also surface "CCGGTT" as a *forward* target k-mer. The only way to keep + // position 7 is therefore the reverse-complement path: it exercises RC + // homology in isolation (regression for the low- vs high-aligned key + // mismatch that previously dropped RC homologs for k < 32). + // Layout: 0..6 = target "AACCGG", 6 = N, 7..13 = RC copy "CCGGTT". + let b = bases("AACCGGNCCGGTT"); + let runs = compute_keep_runs(&b, &[(0, 1)], 6, 0, 0).unwrap(); + assert!(covered(&runs, 0), "target start kept"); + assert!(covered(&runs, 7), "reverse-complement homolog start kept"); + } + + #[test] + fn high_copy_kmer_dropped_by_cap() { + // "AC" repeated -> the 2-mer "AC" occurs many times. With cap=2 it is + // dropped, so only the target interval itself is kept (no homology halo). + let b = bases("ACACACACACACACAC"); + let capped = compute_keep_runs(&b, &[(0, 2)], 2, 2, 0).unwrap(); + let kept_bp: u64 = capped.iter().map(|&(s, e)| e - s).sum(); + assert_eq!(kept_bp, 2, "over-cap homology dropped; only target kept"); + // Uncapped: the homologous starts are kept too (more than 2 bp). + let uncapped = compute_keep_runs(&b, &[(0, 2)], 2, 0, 0).unwrap(); + let kept_bp_u: u64 = uncapped.iter().map(|&(s, e)| e - s).sum(); + assert!(kept_bp_u > 2, "uncapped keeps homologous AC starts"); + } + + #[test] + fn inverted_repeat_counts_toward_cap() { + // The target k-mer "AC" (at 0) occurs once forward, but its reverse + // complement "GT" recurs four times in the "GTGTGTGT" tail. Because the + // cap is applied on the strand-canonical key, the AC/GT family count is + // 1 + 4 = 5, so an inverted high-copy repeat cannot slip under the cap. + let b = bases("ACGTGTGTGT"); + // cap = 3 < 5 -> the whole family is dropped; only the target is kept. + let capped = compute_keep_runs(&b, &[(0, 1)], 2, 3, 0).unwrap(); + let kept_bp: u64 = capped.iter().map(|&(s, e)| e - s).sum(); + assert_eq!(kept_bp, 1, "inverted high-copy repeat dropped by the cap"); + // Uncapped, the four reverse-complement homolog starts are kept too. + let uncapped = compute_keep_runs(&b, &[(0, 1)], 2, 0, 0).unwrap(); + let kept_bp_u: u64 = uncapped.iter().map(|&(s, e)| e - s).sum(); + assert_eq!(kept_bp_u, 5, "uncapped keeps the RC homolog starts (0,2,4,6,8)"); + } + + #[test] + fn flank_extends_and_merges_runs() { + // Exercise the run-extraction + flank + merge logic directly on a + // bitmap (isolated from homology). Single kept position 5. + let mut keep = vec![false; 12]; + keep[5] = true; + assert_eq!(runs_from_bitmap(&keep, 0), vec![(5, 6)]); + assert_eq!(runs_from_bitmap(&keep, 1), vec![(4, 7)], "flank=1 widens to [4,7)"); + // Two nearby positions whose flanks overlap must merge into one run. + let mut keep2 = vec![false; 12]; + keep2[3] = true; + keep2[5] = true; + assert_eq!(runs_from_bitmap(&keep2, 1), vec![(2, 7)], "overlapping flanks merge"); + // Flank clamps at the genome bounds. + let mut keep3 = vec![false; 5]; + keep3[0] = true; + keep3[4] = true; + assert_eq!(runs_from_bitmap(&keep3, 10), vec![(0, 5)], "flank clamps to [0,len]"); + } + + #[test] + fn invalid_k_rejected() { + let b = bases("ACGT"); + assert!(compute_keep_runs(&b, &[], 0, 0, 0).is_err()); + assert!(compute_keep_runs(&b, &[], 33, 0, 0).is_err()); + } + + #[test] + fn bed3_and_bed12_decode_to_identical_keepset() { + // Emit the same runs as BED3 and BED12, parse both back through the + // builder's parse_bed, and assert identical covered positions. + let runs = vec![(10u64, 12u64), (20, 21), (100, 130)]; + let mut f3 = NamedTempFile::new().unwrap(); + emit_bed3(&mut f3, "genome", &runs).unwrap(); + f3.flush().unwrap(); + let mut f12 = NamedTempFile::new().unwrap(); + emit_bed12(&mut f12, "genome", &runs, 2).unwrap(); + f12.flush().unwrap(); + let iv3 = parse_bed(f3.path()).unwrap(); + let iv12 = parse_bed(f12.path()).unwrap(); + for p in 0..140u64 { + assert_eq!( + covered_by_bed(&iv3, p), + covered_by_bed(&iv12, p), + "BED3 and BED12 disagree at flat position {p}" + ); + } + // Spot-check the keep-set content itself. + assert!(covered_by_bed(&iv3, 10) && covered_by_bed(&iv3, 11)); + assert!(!covered_by_bed(&iv3, 12)); + assert!(covered_by_bed(&iv3, 20) && !covered_by_bed(&iv3, 21)); + assert!(covered_by_bed(&iv3, 129) && !covered_by_bed(&iv3, 130)); + } + + #[test] + fn target_bed_maps_per_contig_to_flat() { + // Two contigs of length 10 and 8; a target on the second contig maps to + // flat offset 10 + local. + let contigs = vec![ + Contig { name: "chr1".into(), offset: 0, len: 10 }, + Contig { name: "chr2".into(), offset: 10, len: 8 }, + ]; + let mut bed = NamedTempFile::new().unwrap(); + writeln!(bed, "chr2\t2\t5").unwrap(); + bed.flush().unwrap(); + let flat = parse_target_bed_to_flat(bed.path(), &contigs).unwrap(); + assert_eq!(flat, vec![(12, 15)]); + } + + #[test] + fn duplicate_fasta_contig_names_rejected() { + // Duplicate names would collapse in the name->offset map and misroute + // targets, so reading the reference must fail with InvalidInput. + let mut fa = NamedTempFile::new().unwrap(); + writeln!(fa, ">chr1\nACGT\n>chr1\nTTTT").unwrap(); + fa.flush().unwrap(); + let err = read_fasta_contigs(fa.path()).unwrap_err(); + assert!( + matches!(err, Error::InvalidInput { .. }), + "expected InvalidInput for duplicate contig name, got {err:?}" + ); + // A unique-named reference still reads cleanly. + let mut ok = NamedTempFile::new().unwrap(); + writeln!(ok, ">chr1\nACGT\n>chr2\nTTTT").unwrap(); + ok.flush().unwrap(); + let (bases, contigs) = read_fasta_contigs(ok.path()).unwrap(); + assert_eq!(bases.len(), 8); + assert_eq!(contigs.len(), 2); + } + + #[test] + fn canonical_low_key_unifies_strands() { + // A k-mer and its reverse complement share one canonical key. + let acgtac = 0b00_01_10_11_00_01u64; // A C G T A C, low-aligned, k=6 + let rc = reverse_complement_low(acgtac, 6); + assert_eq!(canonical_low_key(acgtac, 6), canonical_low_key(rc, 6)); + // Reverse complement is an involution on the low-aligned encoding. + assert_eq!(reverse_complement_low(rc, 6), acgtac); + } + + #[test] + fn target_bed_rejects_unknown_chrom_and_overrun() { + let contigs = vec![Contig { name: "chr1".into(), offset: 0, len: 10 }]; + let mut bad_chrom = NamedTempFile::new().unwrap(); + writeln!(bad_chrom, "chrX\t0\t5").unwrap(); + bad_chrom.flush().unwrap(); + assert!(parse_target_bed_to_flat(bad_chrom.path(), &contigs).is_err()); + let mut overrun = NamedTempFile::new().unwrap(); + writeln!(overrun, "chr1\t0\t20").unwrap(); + overrun.flush().unwrap(); + assert!(parse_target_bed_to_flat(overrun.path(), &contigs).is_err()); + } + + #[test] + fn target_bed_requires_exact_bed3() { + // A wider record (BED6, BED12) must be rejected rather than silently + // collapsed to its outer [start, end) span, since the keep-set output is + // decoded block-precise by parse_bed. + let contigs = vec![Contig { + name: "chr1".into(), + offset: 0, + len: 100, + }]; + // BED6: 6 columns -> rejected. + let mut bed6 = NamedTempFile::new().unwrap(); + writeln!(bed6, "chr1\t0\t50\tname\t0\t+").unwrap(); + bed6.flush().unwrap(); + assert!(matches!( + parse_target_bed_to_flat(bed6.path(), &contigs), + Err(Error::InvalidInput { .. }) + )); + // BED12: an exon-block transcript -> rejected (not widened to [10,90)). + let mut bed12 = NamedTempFile::new().unwrap(); + writeln!(bed12, "chr1\t10\t90\ttx\t0\t+\t10\t90\t0\t2\t5,5,\t0,75,").unwrap(); + bed12.flush().unwrap(); + assert!(matches!( + parse_target_bed_to_flat(bed12.path(), &contigs), + Err(Error::InvalidInput { .. }) + )); + // Exact BED3 still parses. + let mut bed3 = NamedTempFile::new().unwrap(); + writeln!(bed3, "chr1\t10\t20").unwrap(); + bed3.flush().unwrap(); + assert_eq!( + parse_target_bed_to_flat(bed3.path(), &contigs).unwrap(), + vec![(10, 20)] + ); + } + + #[test] + fn compute_keep_runs_rejects_invalid_targets() { + // compute_keep_runs is public and returns Result, so malformed intervals + // must be rejected, not silently clipped (an inverted range would also + // panic the bitmap slice). Genome below is length 10. + let b = bases("ACGTACGTAC"); + // end > genome length. + assert!(matches!( + compute_keep_runs(&b, &[(0, 20)], 4, 0, 0), + Err(Error::InvalidInput { .. }) + )); + // end <= start. + assert!(matches!( + compute_keep_runs(&b, &[(5, 5)], 4, 0, 0), + Err(Error::InvalidInput { .. }) + )); + assert!(matches!( + compute_keep_runs(&b, &[(8, 3)], 4, 0, 0), + Err(Error::InvalidInput { .. }) + )); + // A valid in-range interval still succeeds. + assert!(compute_keep_runs(&b, &[(2, 5)], 4, 0, 0).is_ok()); + } +} diff --git a/prmi/src/lib.rs b/prmi/src/lib.rs index 89b49ea..4212238 100644 --- a/prmi/src/lib.rs +++ b/prmi/src/lib.rs @@ -14,6 +14,7 @@ pub mod fasta; pub mod histogram; pub mod index; pub mod inspect; +pub mod keepset; pub mod pac; pub mod sa; pub mod sidecar; From b040c6b1749caef0e0555b5d5b1fdbb6fe3e5100 Mon Sep 17 00:00:00 2001 From: Nils Homer Date: Mon, 22 Jun 2026 10:59:14 -0700 Subject: [PATCH 3/4] fix(keepset): saturating_add for the flank upper bound (sibling to saturating_sub) Address review: the lower flank bound uses saturating_sub but the upper used `b + flank`, an inconsistent overflow path. Use saturating_add to match. --- prmi/src/keepset.rs | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/prmi/src/keepset.rs b/prmi/src/keepset.rs index 88b3763..2bd1580 100644 --- a/prmi/src/keepset.rs +++ b/prmi/src/keepset.rs @@ -384,7 +384,7 @@ fn runs_from_bitmap(keep: &[bool], flank: u64) -> Vec<(u64, u64)> { let (mut a, mut b) = (s as u64, i as u64); if flank > 0 { a = a.saturating_sub(flank); - b = (b + flank).min(n as u64); + b = b.saturating_add(flank).min(n as u64); } runs.push((a, b)); } From d40e7556338d549459a6bdeacfd53417a6c13953 Mon Sep 17 00:00:00 2001 From: Nils Homer Date: Tue, 23 Jun 2026 14:23:30 -0700 Subject: [PATCH 4/4] style(keepset): apply rustfmt to keepset CLI and BED12 changes Newer nightly rustfmt (unpinned CI fmt toolchain) reformats these; apply it so the fmt check passes. Formatting only. --- prmi/src/keepset.rs | 65 ++++++++++++++++++++++++++++++------------ prmi/src/train/mask.rs | 11 +++++-- 2 files changed, 55 insertions(+), 21 deletions(-) diff --git a/prmi/src/keepset.rs b/prmi/src/keepset.rs index 2bd1580..50c9397 100644 --- a/prmi/src/keepset.rs +++ b/prmi/src/keepset.rs @@ -148,12 +148,8 @@ fn read_fasta_contigs(path: &Path) -> Result<(Vec, Vec)> { /// Parse a per-contig BED3 target file and map each interval into flat /// coordinates using the contig table. The chrom column must name a contig in /// the reference; `end` must not exceed the contig length. -fn parse_target_bed_to_flat( - path: &Path, - contigs: &[Contig], -) -> Result> { - let by_name: HashMap<&str, &Contig> = - contigs.iter().map(|c| (c.name.as_str(), c)).collect(); +fn parse_target_bed_to_flat(path: &Path, contigs: &[Contig]) -> Result> { + let by_name: HashMap<&str, &Contig> = contigs.iter().map(|c| (c.name.as_str(), c)).collect(); let text = std::fs::read_to_string(path).map_err(|source| Error::Io { path: path.to_path_buf(), source, @@ -228,7 +224,11 @@ fn parse_target_bed_to_flat( /// The rolling code resets at any [`N_SENTINEL`] base, so no window spans an N. /// `k` must be in 1..=32 (caller-validated). fn for_each_kmer(bases: &[u8], k: usize, mut f: impl FnMut(usize, u64)) { - let mask: u64 = if k == 32 { u64::MAX } else { (1u64 << (2 * k)) - 1 }; + let mask: u64 = if k == 32 { + u64::MAX + } else { + (1u64 << (2 * k)) - 1 + }; let mut code: u64 = 0; let mut valid: usize = 0; for (i, &b) in bases.iter().enumerate() { @@ -428,8 +428,10 @@ fn emit_bed12( let span_start = chunk[0].0; let span_end = chunk[chunk.len() - 1].1; let sizes: Vec = chunk.iter().map(|&(s, e)| (e - s).to_string()).collect(); - let starts: Vec = - chunk.iter().map(|&(s, _)| (s - span_start).to_string()).collect(); + let starts: Vec = chunk + .iter() + .map(|&(s, _)| (s - span_start).to_string()) + .collect(); writeln!( out, "{chrom}\t{span_start}\t{span_end}\tkeep\t0\t+\t{span_start}\t{span_end}\t0\t{}\t{}\t{}", @@ -465,9 +467,7 @@ pub fn build_keepset( let kept_bp: u64 = runs.iter().map(|&(s, e)| e - s).sum(); let lines_written = match opts.format { KeepsetFormat::Bed3 => emit_bed3(out, &opts.chrom_label, &runs)?, - KeepsetFormat::Bed12 => { - emit_bed12(out, &opts.chrom_label, &runs, opts.blocks_per_line)? - } + KeepsetFormat::Bed12 => emit_bed12(out, &opts.chrom_label, &runs, opts.blocks_per_line)?, }; Ok(KeepsetStats { genome_len, @@ -573,7 +573,10 @@ mod tests { // Uncapped, the four reverse-complement homolog starts are kept too. let uncapped = compute_keep_runs(&b, &[(0, 1)], 2, 0, 0).unwrap(); let kept_bp_u: u64 = uncapped.iter().map(|&(s, e)| e - s).sum(); - assert_eq!(kept_bp_u, 5, "uncapped keeps the RC homolog starts (0,2,4,6,8)"); + assert_eq!( + kept_bp_u, 5, + "uncapped keeps the RC homolog starts (0,2,4,6,8)" + ); } #[test] @@ -583,17 +586,29 @@ mod tests { let mut keep = vec![false; 12]; keep[5] = true; assert_eq!(runs_from_bitmap(&keep, 0), vec![(5, 6)]); - assert_eq!(runs_from_bitmap(&keep, 1), vec![(4, 7)], "flank=1 widens to [4,7)"); + assert_eq!( + runs_from_bitmap(&keep, 1), + vec![(4, 7)], + "flank=1 widens to [4,7)" + ); // Two nearby positions whose flanks overlap must merge into one run. let mut keep2 = vec![false; 12]; keep2[3] = true; keep2[5] = true; - assert_eq!(runs_from_bitmap(&keep2, 1), vec![(2, 7)], "overlapping flanks merge"); + assert_eq!( + runs_from_bitmap(&keep2, 1), + vec![(2, 7)], + "overlapping flanks merge" + ); // Flank clamps at the genome bounds. let mut keep3 = vec![false; 5]; keep3[0] = true; keep3[4] = true; - assert_eq!(runs_from_bitmap(&keep3, 10), vec![(0, 5)], "flank clamps to [0,len]"); + assert_eq!( + runs_from_bitmap(&keep3, 10), + vec![(0, 5)], + "flank clamps to [0,len]" + ); } #[test] @@ -635,8 +650,16 @@ mod tests { // Two contigs of length 10 and 8; a target on the second contig maps to // flat offset 10 + local. let contigs = vec![ - Contig { name: "chr1".into(), offset: 0, len: 10 }, - Contig { name: "chr2".into(), offset: 10, len: 8 }, + Contig { + name: "chr1".into(), + offset: 0, + len: 10, + }, + Contig { + name: "chr2".into(), + offset: 10, + len: 8, + }, ]; let mut bed = NamedTempFile::new().unwrap(); writeln!(bed, "chr2\t2\t5").unwrap(); @@ -678,7 +701,11 @@ mod tests { #[test] fn target_bed_rejects_unknown_chrom_and_overrun() { - let contigs = vec![Contig { name: "chr1".into(), offset: 0, len: 10 }]; + let contigs = vec![Contig { + name: "chr1".into(), + offset: 0, + len: 10, + }]; let mut bad_chrom = NamedTempFile::new().unwrap(); writeln!(bad_chrom, "chrX\t0\t5").unwrap(); bad_chrom.flush().unwrap(); diff --git a/prmi/src/train/mask.rs b/prmi/src/train/mask.rs index 6f524cb..02fa8d0 100644 --- a/prmi/src/train/mask.rs +++ b/prmi/src/train/mask.rs @@ -513,7 +513,11 @@ mod tests { let mut f = NamedTempFile::new().unwrap(); writeln!(f, "chr1\t100\t200\tr\t0\t+\t100\t200\t0\t2\t10,20\t0,50").unwrap(); let intervals = parse_bed(f.path()).unwrap(); - assert_eq!(intervals.len(), 2, "two disjoint blocks, not the whole span"); + assert_eq!( + intervals.len(), + 2, + "two disjoint blocks, not the whole span" + ); assert_eq!((intervals[0].start, intervals[0].end), (100, 110)); assert_eq!((intervals[1].start, intervals[1].end), (150, 170)); assert!(covered_by_bed(&intervals, 100)); @@ -523,7 +527,10 @@ mod tests { assert!(covered_by_bed(&intervals, 150)); assert!(covered_by_bed(&intervals, 169)); assert!(!covered_by_bed(&intervals, 170), "block2 end is exclusive"); - assert!(!covered_by_bed(&intervals, 199), "span tail past last block not kept"); + assert!( + !covered_by_bed(&intervals, 199), + "span tail past last block not kept" + ); } #[test]